murJ [2018-04-03 18:50:14]

lipid II flippase

Locus: BSU30050

Isoelectric point: 10.09

Molecular weight: 59.30 kDa

Protein length: 544 aa

Gene length: 1632 bp

Function: export of lipid II

Product: lipid II flippase

Essential: no

Synonyms: ytgP

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Cell envelope and cell division → Cell wall synthesis → Biosynthesis of peptidoglycan
• Metabolism → Additional metabolic pathways → Biosynthesis of cell wall components → Biosynthesis of peptidoglycan
• Groups of genes → Membrane proteins

Gene

Coordinates: 3,073,531 → 3,075,165

Phenotypes of a mutant

• an amj murJ double mutant is not viable PubMed
• a sigM murJ double mutant is not viable (due to the lack of both lipid II flippases) PubMed
• mutants lacking MurJ produce long cells and chains of cells PubMed

The protein

Protein family

• MOP exporter family

Paralogous protein(s)

• YkvU, SpoVB, YabM

Structure

• 5T77 (from Thermosipho africanus, 20% identity) PubMed

Expression and Regulation

Operons

• Genes: murJ-ytzG
  Description: PubMed

Biological materials

Mutant

• MGNA-A012 (ytgP::erm), available at the NBRP B. subtilis, Japan
• BKE30050 (ΔmurJ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTCTTCATCACCATT, downstream forward: _UP4_TGATGAACTAGATATGATGA
• BKK30050 (ΔmurJ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTCTTCATCACCATT, downstream forward: _UP4_TGATGAACTAGATATGATGA

References

Reviews

Loading

Original Publications

Loading